Mature hsa-miR-185-5p
| Accession | MIMAT0000455 |
| Description | hsa-miR-185-5p mature miRNA |
| Hairpins | |
| Sequence | UGGAGAGAAAGGCAGUUCCUGA |
| Evidence |
experimental
cloned [2-4], Illumina [5] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| acts_upstream_of | GO:0010989 negative regulation of low-density lipoprotein particle clearance |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:24296663 | occurs_in CL:0000182 |
| acts_upstream_of | GO:0030336 negative regulation of cell migration |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26316588 | |
| acts_upstream_of | GO:0030889 negative regulation of B cell proliferation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:24803541 | |
| acts_upstream_of | GO:0032720 negative regulation of tumor necrosis factor production |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:24803541 | occurs_in CL:0000236 |
| acts_upstream_of | GO:0045541 negative regulation of cholesterol biosynthetic process |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23951060 | |
| acts_upstream_of | GO:0045541 negative regulation of cholesterol biosynthetic process |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:24296663 | occurs_in CL:0000182 |
| acts_upstream_of | GO:0045717 negative regulation of fatty acid biosynthetic process |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23951060 | |
| acts_upstream_of | GO:0050869 negative regulation of B cell activation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:24803541 | |
| acts_upstream_of | GO:1905601 negative regulation of receptor-mediated endocytosis involved in cholesterol transport |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:24296663 | occurs_in CL:0000182 |
| acts_upstream_of | GO:1905700 negative regulation of xenobiotic detoxification by transmembrane export across the plasma membrane |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:27906433 | |
| enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24803541 | has_input UniProtKB:P29323 |
| enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26316588 | |
| enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27906433 | has_input UniProtKB:P33527 |
| enables | GO:0106222 lncRNA binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29053187 | |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23459944 | has_input UniProtKB:Q8WTV0 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23951060 | has_input UniProtKB:P36956 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:24296663 | has_input UniProtKB:Q12772 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24803541 | has_input UniProtKB:P29323 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26316588 | has_input UniProtKB:Q15109 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26523989 | has_input UniProtKB:P01130 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26523989 | has_input UniProtKB:Q92945 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26694763 | has_input UniProtKB:Q13586 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27906433 | has_input UniProtKB:P33527 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29053187 | has_input UniProtKB:P01137 |
| involved_in | GO:0009968 negative regulation of signal transduction |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26316588 |
StarBase
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
| Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
|---|
miR2Disease
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
| Disease | Differential expression | Experiment | Year | Study |
|---|
