miRBase entry: hsa-mir-185

Stem-loop hsa-mir-185


Accession
MI0000482
Symbol
HGNC: MIR185
Description
Homo sapiens hsa-mir-185 precursor miRNA mir-185
Gene
family?
RF00771; mir-185

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR185 is a microRNA that has been identified in fibrotic livers through in-situ hybridization assays, indicating its histological distribution in such tissues [PMC5039723]. This microRNA, conserved across species, has been shown to target ARID1A, a gene involved in chromatin remodeling [PMC8367751]. Its expression is influenced by external factors such as celecoxib exposure in lung tissue, where it is downregulated [PMC6154745]. Furthermore, MIR185 has been implicated in the regulation of pro-angiogenic activity through its association with VEGFR expression levels [PMC7048408]. Despite its various roles in different biological processes and diseases, there is no clear evidence linking MIR185 levels or single nucleotide polymorphisms (SNPs) within the gene to schizophrenia [PMC8307070]. In the immune system, low levels of MIR185 in B cells are correlated with the production of autoreactive antibodies and autoimmune features [PMC3956820]. Additionally, it has been suggested that MIR185 may control the expression of genes related to the Golgi apparatus and neuronal maturation [PMC3828562].

Literature search
118 open access papers mention hsa-mir-185
(783 sentences)

Sequence

507017 reads, 1786 reads per million, 140 experiments
agggggcgagggauUGGAGAGAAAGGCAGUUCCUGAugguccccuccccAGGGGCUGGCUUUCCUCUGGUCcuucccuccca
.(((((.((((((((((((.(((((.(((((((((..((......)).))))))))).))))))))))))))))).))))).

Structure
a     c            A     G         Au  uc 
 ggggg gagggauUGGAG GAAAG CAGUUCCUG  gg  c
 ||||| |||||||||||| ||||| |||||||||  ||   
 cccuc cuucCUGGUCUC CUUUC GUCGGGGAc  cc  c
a     c            -     G         -c  uc 


Annotation confidence High
Do you think this miRNA is real?
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. Its expression was later verified in human BC-1 cells [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
chr22: 20033139-20033220 [+]

Disease association
hsa-mir-185 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-185-5p

Accession MIMAT0000455
Description Homo sapiens hsa-miR-185-5p mature miRNA
Sequence 15 - UGGAGAGAAAGGCAGUUCCUGA - 36
Evidence experimental
cloned [2-4], Illumina [5]
Database links
Predicted targets

Mature hsa-miR-185-3p

Accession MIMAT0004611
Description Homo sapiens hsa-miR-185-3p mature miRNA
Sequence 50 - AGGGGCUGGCUUUCCUCUGGUC - 71
Evidence experimental
cloned [3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 20158877
    Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
    Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
    BMC Genomics (2010) 11:S6

  4. PubMed ID: 12554859
    New microRNAs from mouse and human
    "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
    "RNA (2003) 9:175-179

  5. PubMed ID: 15800047
    Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells
    "Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR"
    "Proc Natl Acad Sci U S A (2005) 102:5570-5575