miRBase entry: hsa-mir-185

Stem-loop hsa-mir-185


Accession
MI0000482
Symbol
HGNC: MIR185
Description
Homo sapiens hsa-mir-185 precursor miRNA mir-185
Gene
family?
RF00771; mir-185

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR185 is a microRNA that has been studied in various contexts. In fibrotic livers, an in-situ hybridization assay of MIR185 in human liver fibrotic samples was performed to examine its histological distribution [PMC5039723]. MIR185 is one of the two miRNAs conserved in mice, the other being MIR1306 [PMC4487986]. It has been shown that MIR185 targets ARID1A using miRNA mimics and inhibitors [PMC8367751]. In a study on lung, low dose celecoxib was found to modulate the expression of miR-296 and miR-551b (upregulation) and downregulate the expression of MIR185 [PMC6154745]. Elevated levels of MIR185 were associated with high vascular endothelial growth factor receptor 2 (VEGFR) expression and pro-angiogenic activity in ccRCC [PMC7048408]. However, there is no firm evidence of alteration of miR-185 levels and SNP in MIR185 associated with schizophrenia in humans [PMC8307070]. In mice, low levels of MIR185 in B cells were found to lead to high titers of autoreactive antibodies and autoimmune features [PMC3956820]. Additionally, a study suggested that MIR185 controls the expression of Golgi-apparatus related genes including a new inhibitor of neuronal maturation [PMC3828562].

Literature search
118 open access papers mention hsa-mir-185
(783 sentences)

Sequence

507017 reads, 2631 reads per million, 140 experiments
agggggcgagggauUGGAGAGAAAGGCAGUUCCUGAugguccccuccccAGGGGCUGGCUUUCCUCUGGUCcuucccuccca
.(((((.((((((((((((.(((((.(((((((((..((......)).))))))))).))))))))))))))))).))))).

Structure
a     c            A     G         Au  uc 
 ggggg gagggauUGGAG GAAAG CAGUUCCUG  gg  c
 ||||| |||||||||||| ||||| |||||||||  ||   
 cccuc cuucCUGGUCUC CUUUC GUCGGGGAc  cc  c
a     c            -     G         -c  uc 


Annotation confidence High
Do you think this miRNA is real?
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. Its expression was later verified in human BC-1 cells [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
chr22: 20033139-20033220 [+]

Disease association
hsa-mir-185 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-185-5p

Accession MIMAT0000455
Description Homo sapiens hsa-miR-185-5p mature miRNA
Sequence 15 - UGGAGAGAAAGGCAGUUCCUGA - 36
Evidence experimental
cloned [2-4], Illumina [5]
Database links
Predicted targets

Mature hsa-miR-185-3p

Accession MIMAT0004611
Description Homo sapiens hsa-miR-185-3p mature miRNA
Sequence 50 - AGGGGCUGGCUUUCCUCUGGUC - 71
Evidence experimental
cloned [3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 20158877
    Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
    Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
    BMC Genomics (2010) 11:S6

  4. PubMed ID: 12554859
    New microRNAs from mouse and human
    "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
    "RNA (2003) 9:175-179

  5. PubMed ID: 15800047
    Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells
    "Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR"
    "Proc Natl Acad Sci U S A (2005) 102:5570-5575