MIR185 is a microRNA that has been studied in various contexts. In fibrotic livers, an in-situ hybridization assay of MIR185 in human liver fibrotic samples was performed to examine its histological distribution [PMC5039723]. MIR185 is one of the two miRNAs conserved in mice, the other being MIR1306 [PMC4487986]. It has been shown that MIR185 targets ARID1A using miRNA mimics and inhibitors [PMC8367751]. In a study on lung, low dose celecoxib was found to modulate the expression of miR-296 and miR-551b (upregulation) and downregulate the expression of MIR185 [PMC6154745]. Elevated levels of MIR185 were associated with high vascular endothelial growth factor receptor 2 (VEGFR) expression and pro-angiogenic activity in ccRCC [PMC7048408]. However, there is no firm evidence of alteration of miR-185 levels and SNP in MIR185 associated with schizophrenia in humans [PMC8307070]. In mice, low levels of MIR185 in B cells were found to lead to high titers of autoreactive antibodies and autoimmune features [PMC3956820]. Additionally, a study suggested that MIR185 controls the expression of Golgi-apparatus related genes including a new inhibitor of neuronal maturation [PMC3828562].
a c A G Au uc ggggg gagggauUGGAG GAAAG CAGUUCCUG gg c ||||| |||||||||||| ||||| ||||||||| || cccuc cuucCUGGUCUC CUUUC GUCGGGGAc cc c a c - G -c uc
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000455 |
Description | Homo sapiens hsa-miR-185-5p mature miRNA |
Sequence | 15 - UGGAGAGAAAGGCAGUUCCUGA - 36 |
Evidence |
experimental
cloned [2-4], Illumina [5] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004611 |
Description | Homo sapiens hsa-miR-185-3p mature miRNA |
Sequence | 50 - AGGGGCUGGCUUUCCUCUGGUC - 71 |
Evidence |
experimental
cloned [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|