WARNING: This summary was generated by AI. MIR185 is a microRNA that has been identified in fibrotic livers through in-situ hybridization assays, indicating its histological distribution in such tissues [PMC5039723]. This microRNA, conserved across species, has been shown to target ARID1A, a gene involved in chromatin remodeling [PMC8367751]. Its expression is influenced by external factors such as celecoxib exposure in lung tissue, where it is downregulated [PMC6154745]. Furthermore, MIR185 has been implicated in the regulation of pro-angiogenic activity through its association with VEGFR expression levels [PMC7048408]. Despite its various roles in different biological processes and diseases, there is no clear evidence linking MIR185 levels or single nucleotide polymorphisms (SNPs) within the gene to schizophrenia [PMC8307070]. In the immune system, low levels of MIR185 in B cells are correlated with the production of autoreactive antibodies and autoimmune features [PMC3956820]. Additionally, it has been suggested that MIR185 may control the expression of genes related to the Golgi apparatus and neuronal maturation [PMC3828562].
a c A G Au uc ggggg gagggauUGGAG GAAAG CAGUUCCUG gg c ||||| |||||||||||| ||||| ||||||||| || cccuc cuucCUGGUCUC CUUUC GUCGGGGAc cc c a c - G -c uc
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000455 |
| Description | Homo sapiens hsa-miR-185-5p mature miRNA |
| Sequence | 15 - UGGAGAGAAAGGCAGUUCCUGA - 36 |
| Evidence |
experimental
cloned [2-4], Illumina [5] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004611 |
| Description | Homo sapiens hsa-miR-185-3p mature miRNA |
| Sequence | 50 - AGGGGCUGGCUUUCCUCUGGUC - 71 |
| Evidence |
experimental
cloned [3] |
| Database links |
|
| Predicted targets |
|
|