Accession | MIMAT0000520 |
Description | mmu-miR-208a-3p mature miRNA |
Hairpins | |
Sequence | AUAAGACGAGCAAAAAGCUUGU |
Evidence |
experimental
cloned [1-2], Illumina [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:17379774 | has_input UniProtKB:Q5SWW4 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19922871 | has_input UniProtKB:P40645 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:20576608 | has_input UniProtKB:P27577 |
involved_in | GO:0002155 regulation of thyroid hormone receptor signaling pathway |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:17379774 | |
involved_in | GO:0010455 positive regulation of cell fate commitment |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:22539765 | results_in_commitment_to CL:0000746 |
involved_in | GO:0010628 positive regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:19726871 | has_input UniProtKB:Q01231 |
involved_in | GO:0010628 positive regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:19922871 | has_input UniProtKB:A2AQP0 |
involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:17379774 | has_input UniProtKB:Q91Z83 |
involved_in | GO:0030502 negative regulation of bone mineralization |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:20576608 | occurs_in CL:0007010 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:17379774 | has_input UniProtKB:Q5SWW4 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:19726871 | has_input UniProtKB:Q5SWW4 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19922871 | has_input UniProtKB:P40645 |
involved_in | GO:0035278 miRNA-mediated gene silencing by inhibition of translation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:20576608 | has_input UniProtKB:P27577 |
involved_in | GO:0042632 cholesterol homeostasis |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:22541436 | occurs_in UBERON:0000948 |
involved_in | GO:0045668 negative regulation of osteoblast differentiation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:20576608 | |
involved_in | GO:0045822 negative regulation of heart contraction |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19726871 | |
involved_in | GO:0061051 positive regulation of cell growth involved in cardiac muscle cell development |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:17379774 | |
involved_in | GO:0061051 positive regulation of cell growth involved in cardiac muscle cell development |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19726871 | |
involved_in | GO:0070328 triglyceride homeostasis |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:22541436 | occurs_in UBERON:0000948 |
involved_in | GO:1903779 regulation of cardiac conduction |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:19726871 | |
involved_in | GO:1905027 regulation of membrane depolarization during AV node cell action potential |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:19726871 |