Accession | MIMAT0000542 |
Description | mmu-miR-34a-5p mature miRNA |
Hairpins | |
Sequence | UGGCAGUGUCUUAGCUGGUUGU |
Evidence |
experimental
cloned [1,3], Illumina [4,6] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
NOT|involved_in | GO:1905203 regulation of connective tissue replacement |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:24587330 | |
NOT|involved_in | GO:1905459 regulation of vascular associated smooth muscle cell apoptotic process |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26493107 | |
acts_upstream_of | GO:0071901 negative regulation of protein serine/threonine kinase activity |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26330104 | has_input UniProtKB:Q13131 |
acts_upstream_of_or_within | GO:0010629 negative regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26330104 | has_input UniProtKB:P23204 |
acts_upstream_of_or_within | GO:0010629 negative regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26330104 | has_input UniProtKB:Q923E4 |
acts_upstream_of_or_within | GO:0035359 negative regulation of peroxisome proliferator activated receptor signaling pathway |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26330104 | has_input UniProtKB:P23204 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24198819 | has_input UniProtKB:P09581 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25322725 | has_input UniProtKB:P97471 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25526086 | has_input UniProtKB:Q923E4 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26100857 | has_input UniProtKB:P49698 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26493107 | has_input UniProtKB:Q01705 |
involved_in | GO:0010628 positive regulation of gene expression |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:23047694 | has_input UniProtKB:P05125 |
involved_in | GO:0010628 positive regulation of gene expression |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:23047694 | has_input UniProtKB:Q91Z83 |
involved_in | GO:0010628 positive regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25322725 | occurs_in CL:0002548 |
involved_in | GO:0010628 positive regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:25322725 | |
involved_in | GO:0010628 positive regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:25322725 | |
involved_in | GO:0010628 positive regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:25322725 | |
involved_in | GO:0010628 positive regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25526086 | has_input UniProtKB:Q923E4 |
involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:23047694 | has_input UniProtKB:Q00731 |
involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26100857 | has_input UniProtKB:E9Q414 |
involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26100857 | has_input UniProtKB:E9Q4Z2 |
involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26100857 | has_input UniProtKB:O08601 |
involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26100857 | has_input UniProtKB:Q9WTN3 |
involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26100857 | occurs_in UBERON:0002107 |
involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26100857 | has_input UniProtKB:Q5SWU9 |