| Accession | MIMAT0000567 |
| Description | mmu-miR-329-3p mature miRNA |
| Hairpins | |
| Sequence | AACACACCCAGCUAACCUUUUU |
| Evidence |
experimental
cloned [3], Illumina [4,6] |
| Database links |
|
| Predicted targets |
|
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.