Mature mmu-miR-329-3p
| Accession | MIMAT0000567 |
| Description | mmu-miR-329-3p mature miRNA |
| Hairpins | |
| Sequence | AACACACCCAGCUAACCUUUUU |
| Evidence |
experimental
cloned [3], Illumina [4,6] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| involved_in | GO:1903671 negative regulation of sprouting angiogenesis |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:25085941 | occurs_in UBERON:0001389 |
| involved_in | GO:1905652 negative regulation of artery morphogenesis |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:25085941 |
