miRBase entry: mmu-mir-329

Stem-loop mmu-mir-329


Accession
MI0000605
Symbol
MGI: Mir329
Description
Mus musculus mmu-mir-329 precursor miRNA mir-329
Gene
family?
RF04295; mir-329

Literature search
19 open access papers mention mmu-mir-329
(100 sentences)

Sequence

14341 reads, 312 reads per million, 73 experiments
uguucgcuucugguaccggaagAGAGGUUUUCUGGGUCUCUGUUucuuugaugagaaugaAACACACCCAGCUAACCUUUUUuucaguaucaaaucc
..........((((((.((((((((((((..((((((...((((((.((......)).)))))).))))))..)))))))))))).)))))).....

Structure
uguucgcuuc      c            UU      CUC      u  ga 
          ugguac ggaagAGAGGUU  CUGGGU   UGUUuc uu  u
          |||||| ||||||||||||  ||||||   |||||| ||   
          acuaug cuuUUUUUCCAA  GACCCA   ACAAag aa  g
-----ccuaa      a            UC      --C      u  ga 


Annotation confidence High
Do you think this miRNA is real?
Comments
Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA is predicted based on homology to the verified rat sequence (MIR:MI0000604). Seitz et al. independently predicted the miRNA hairpin precursor sequence by conservation between mouse and human [2]. Landgraf et al. verified expression by cloining [3].

Genome context
chr12: 109713481-109713577 [+]
Clustered miRNAs
18 other miRNAs are < 10 kb from mmu-mir-329
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-329-5p

Accession MIMAT0017032
Description Mus musculus mmu-miR-329-5p mature miRNA
Sequence 23 - AGAGGUUUUCUGGGUCUCUGUU - 44
Evidence experimental
454 [5], Illumina [6]
Database links
Predicted targets

Mature mmu-miR-329-3p

Accession MIMAT0000567
Description Mus musculus mmu-miR-329-3p mature miRNA
Sequence 61 - AACACACCCAGCUAACCUUUUU - 82
Evidence experimental
cloned [3], Illumina [4,6]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 20668074
    Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
    "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
    "J Virol (2010) 84:10266-10275

  5. PubMed ID: 15310658
    A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain
    "Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J"
    "Genome Res (2004) 14:1741-1748

  6. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365