Accession | MIMAT0000649 |
Description | mmu-miR-17-5p mature miRNA |
Hairpins | |
Sequence | CAAAGUGCUUACAGUGCAGGUAG |
Evidence |
experimental
cloned [5], Illumina [6-7] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21145505 | has_input UniProtKB:B9EII4 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21145505 | has_input UniProtKB:P61372 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22267003 | has_input UniProtKB:Q8CCH7 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23825222 | has_input UniProtKB:Q6PI17 |
involved_in | GO:0003151 outflow tract morphogenesis |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:21145505 | occurs_in UBERON:0000922 |
involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:22161164 | occurs_in UBERON:0001981 |
involved_in | GO:0010666 positive regulation of cardiac muscle cell apoptotic process |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:25200830 | |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21145505 | has_input UniProtKB:P61372 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21145505 | has_input UniProtKB:B9EII4 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22267003 | has_input UniProtKB:Q8CCH7 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23825222 | has_input UniProtKB:P12032 |
involved_in | GO:0035278 miRNA-mediated gene silencing by inhibition of translation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23825222 | has_input UniProtKB:Q6PI17 |
involved_in | GO:0045777 positive regulation of blood pressure |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:22161164 | occurs_in UBERON:0002080 |
involved_in | GO:0050766 positive regulation of phagocytosis |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23562609 | occurs_in CL:0000235 |
involved_in | GO:0055118 negative regulation of cardiac muscle contraction |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23825222 | |
involved_in | GO:0071222 cellular response to lipopolysaccharide |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23562609 | occurs_in CL:0000235 |
involved_in | GO:0090091 positive regulation of extracellular matrix disassembly |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23825222 | |
involved_in | GO:1900017 positive regulation of cytokine production involved in inflammatory response |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:23562609 | occurs_in CL:0000235 |
involved_in | GO:1903244 positive regulation of cardiac muscle hypertrophy in response to stress |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:22161164 | |
involved_in | GO:1904707 positive regulation of vascular associated smooth muscle cell proliferation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:22161164 | occurs_in UBERON:0002012 |
involved_in | GO:1905050 positive regulation of metallopeptidase activity |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23825222 | has_input UniProtKB:P41245 |
involved_in | GO:1905111 positive regulation of pulmonary blood vessel remodeling |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:22161164 | occurs_in UBERON:0002012 |
involved_in | GO:1905149 positive regulation of smooth muscle hypertrophy |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:22161164 | occurs_in UBERON:0002012 |