Accession | MIMAT0000661 |
Description | mmu-miR-214-3p mature miRNA |
Hairpins | |
Sequence | ACAGCAGGCACAGACAGGCAGU |
Evidence |
experimental
cloned [3], Illumina [4-5] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27927633 | has_input UniProtKB:P28660 |
involved_in | GO:0010593 negative regulation of lamellipodium assembly |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27927633 | occurs_in CL:0000359 |
involved_in | GO:0010613 positive regulation of cardiac muscle hypertrophy |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:24011070 | occurs_in UBERON:0007023 |
involved_in | GO:0010628 positive regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27288437 | occurs_in CL:0002129 |
involved_in | GO:0010667 negative regulation of cardiac muscle cell apoptotic process |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:27288437 | occurs_in CL:0002129 |
involved_in | GO:0010821 regulation of mitochondrion organization |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:24011070 | occurs_in UBERON:0000948 |
involved_in | GO:0016525 negative regulation of angiogenesis |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:25656649 | |
involved_in | GO:0030837 negative regulation of actin filament polymerization |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27927633 | occurs_in CL:0000359 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:25656649 | |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27927633 | has_input UniProtKB:P28660 |
involved_in | GO:0046322 negative regulation of fatty acid oxidation |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:24011070 | |
involved_in | GO:0051897 positive regulation of phosphatidylinositol 3-kinase/protein kinase B signal transduction |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27288437 | occurs_in CL:0002129 |
involved_in | GO:0051897 positive regulation of phosphatidylinositol 3-kinase/protein kinase B signal transduction |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:27288437 | occurs_in CL:0002129 |
involved_in | GO:1903243 negative regulation of cardiac muscle hypertrophy in response to stress |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:27162619 | occurs_in UBERON:0003101 |
involved_in | GO:1903244 positive regulation of cardiac muscle hypertrophy in response to stress |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:25656649 | |
involved_in | GO:1904706 negative regulation of vascular associated smooth muscle cell proliferation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27927633 | |
involved_in | GO:1904753 negative regulation of vascular associated smooth muscle cell migration |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27927633 | |
involved_in | GO:1905205 positive regulation of connective tissue replacement |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:24011070 | occurs_in UBERON:0007023 |
involved_in | GO:1905205 positive regulation of connective tissue replacement |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:24158985 | occurs_in UBERON:0001231 |
involved_in | GO:1905205 positive regulation of connective tissue replacement |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:25656649 | |
located_in | GO:0005634 nucleus |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24158985 | part_of UBERON:0001231 |