Mature mmu-miR-181b-5p
| Accession | MIMAT0000673 |
| Description | mmu-miR-181b-5p mature miRNA |
| Hairpins | |
| Sequence | AACAUUCAUUGCUGUCGGUGGGUU |
| Evidence |
experimental
cloned [2-4], Illumina [5-6] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28323882 | has_input UniProtKB:A2AGQ4 |
| involved_in | GO:0010917 negative regulation of mitochondrial membrane potential |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28323882 | |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28323882 | has_input UniProtKB:A2AGQ4 |
| involved_in | GO:0050728 negative regulation of inflammatory response |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23650073 | |
| involved_in | GO:0061889 negative regulation of astrocyte activation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23650073 | |
| involved_in | GO:0071356 cellular response to tumor necrosis factor |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28323882 | |
| involved_in | GO:0110015 positive regulation of elastin catabolic process |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:27756793 | occurs_in UBERON:0000947 |
| involved_in | GO:0120041 positive regulation of macrophage proliferation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:27756793 | |
| involved_in | GO:2000271 positive regulation of fibroblast apoptotic process |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28323882 |
