miRBase entry: mmu-mir-181b-1

Stem-loop mmu-mir-181b-1


Accession
MI0000723
Symbol
MGI: Mir181b-1
Description
Mus musculus mmu-mir-181b-1 precursor miRNA

Literature search
165 open access papers mention mmu-mir-181b-1
(1258 sentences)

Sequence

899203 reads, 1790 reads per million, 106 experiments
aggucacaaucAACAUUCAUUGCUGUCGGUGGGUUgaacuguguagaaaagCUCACUGAACAAUGAAUGCAAcuguggcc
.(((((((.....(((((((((...((((((((((...((....))...)))))))))).)))))))))....)))))))

Structure
a       aucAA         CUG          gaa  g 
 ggucaca     CAUUCAUUG   UCGGUGGGUU   cu u
 |||||||     |||||||||   ||||||||||   ||  
 ccggugu     GUAAGUAAC   AGUCACUCga   ga g
-       -cAAC         --A          aaa  u 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr1: 137966639-137966718 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from mmu-mir-181b-1
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-181b-5p

Accession MIMAT0000673
Description Mus musculus mmu-miR-181b-5p mature miRNA
Sequence 12 - AACAUUCAUUGCUGUCGGUGGGUU - 35
Evidence experimental
cloned [2-4], Illumina [5-6]
Database links
Predicted targets

Mature mmu-miR-181b-1-3p

Accession MIMAT0017067
Description Mus musculus mmu-miR-181b-1-3p mature miRNA
Sequence 52 - CUCACUGAACAAUGAAUGCAA - 72
Evidence experimental
454 [6], Illumina [7]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540

  3. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  4. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  5. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  6. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  7. PubMed ID: 20668074
    Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
    "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
    "J Virol (2010) 84:10266-10275