Stem-loop mmu-mir-181b-1

Accession

MI0000723

Symbol

MGI: Mir181b-1

Description

Mus musculus mmu-mir-181b-1 precursor miRNA

Literature search

165 open access papers mention mmu-mir-181b-1
(1258 sentences)

Sequence

899203 reads, 2023 reads per million, 106 experiments

aggucacaaucAACAUUCAUUGCUGUCGGUGGGUUgaacuguguagaaaagCUCACUGAACAAUGAAUGCAAcuguggcc
.(((((((.....(((((((((...((((((((((...((....))...)))))))))).)))))))))....)))))))

Structure

a       aucAA         CUG          gaa  g 
 ggucaca     CAUUCAUUG   UCGGUGGGUU   cu u
 |||||||     |||||||||   ||||||||||   ||  
 ccggugu     GUAAGUAAC   AGUCACUCga   ga g
-       -cAAC         --A          aaa  u 

Annotation confidence High

Genome context

chr1: 137966639-137966718 [+]

Clustered miRNAs

1 other miRNA is < 10 kb from mmu-mir-181b-1

Mature mmu-miR-181b-5p

• Accession: MIMAT0000673
• Description: Mus musculus mmu-miR-181b-5p mature miRNA
• Sequence: 12 - AACAUUCAUUGCUGUCGGUGGGUU - 35
• Evidence: experimental ; cloned [2-4], Illumina [5-6]

Mature mmu-miR-181b-1-3p

• Accession: MIMAT0017067
• Description: Mus musculus mmu-miR-181b-1-3p mature miRNA
• Sequence: 52 - CUCACUGAACAAUGAAUGCAA - 72
• Evidence: experimental ; 454 [6], Illumina [7]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 12624257
   Vertebrate microRNA genes
   "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
   "Science (2003) 299:1540


3. PubMed ID: 15538371
   A pancreatic islet-specific microRNA regulates insulin secretion
   "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
   "Nature (2004) 432:226-230


4. PubMed ID: 16766679
   Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
   "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
   "Genes Dev (2006) 20:1732-1743


5. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


6. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


7. PubMed ID: 20668074
   Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
   "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
   "J Virol (2010) 84:10266-10275