Accession | MIMAT0000718 |
Description | hsa-miR-302d-3p mature miRNA |
Hairpins | |
Sequence | UAAGUGCUUCCAUGUUUGAGUGU |
Evidence |
experimental
cloned [1-2], Northern [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:0032717 negative regulation of interleukin-8 production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26199092 | |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0007005 high throughput direct assay evidence used in manual assertion |
PMID:18320040 | has_input UniProtKB:P15692 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26199092 | has_input UniProtKB:P10145 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0007005 high throughput direct assay evidence used in manual assertion |
PMID:18320040 | has_input UniProtKB:P15692 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26199092 | has_input UniProtKB:P10145 |
involved_in | GO:1904046 negative regulation of vascular endothelial growth factor production |
ECO:0007001 high throughput mutant phenotypic evidence used in manual assertion |
PMID:18320040 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|