Accession | MIMAT0000769 |
Description | mmu-miR-133b-3p mature miRNA |
Hairpins | |
Sequence | UUUGGUCCCCUUCAACCAGCUA |
Evidence |
experimental
cloned [2-3], Illumina [4-5] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24287695 | has_input UniProtKB:P16092 |
involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19521018 | has_input UniProtKB:P42582 |
involved_in | GO:0010831 positive regulation of myotube differentiation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24287695 | |
involved_in | GO:0035278 miRNA-mediated gene silencing by inhibition of translation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24287695 | has_input UniProtKB:P16092 |
involved_in | GO:0070373 negative regulation of ERK1 and ERK2 cascade |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24287695 | |
involved_in | GO:2000134 negative regulation of G1/S transition of mitotic cell cycle |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24287695 | |
involved_in | GO:2000818 negative regulation of myoblast proliferation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24287695 |