miRBase entry: mmu-mir-133b

Stem-loop mmu-mir-133b


Accession
MI0000821
Symbol
MGI: Mir133b
Description
Mus musculus mmu-mir-133b precursor miRNA

Literature search
470 open access papers mention mmu-mir-133b
(1956 sentences)

Sequence

265182 reads, 1445.0 reads per million, 128 experiments
ccuccaaagggaguggcccccugcucugGCUGGUCAAACGGAACCAAGUCcgucuuccugagaggUUUGGUCCCCUUCAACCAGCUAcagcagggcuggcaaagcucaauauuuggaga
.(((((((..((((.((((((((((.((((((((..((.((.((((((.((.((((...)))))))))))).)).))..)))))))).)))))))..)))...))))....))))))).

Structure
c       --gg    --g   --       c        CA  C  A      U  g    c 
 cuccaaa    gagu   gcc  cccugcu ugGCUGGU  AA GG ACCAAG Cc ucuu  
 |||||||    ||||   |||  ||||||| ||||||||  || || |||||| || |||| c
 gagguuu    cucg   cgg  gggacga AUCGACCA  UU CC UGGUUU gg agag  
a       auaa    aaa   uc       c        AC  C  C      -  -    u 


Annotation confidence High
Do you think this miRNA is real?
Comments
miR-133b was predicted based on comparative analysis of human, mouse and Fugu [1]. It is homologous to miR-133a (MIR:MI0000159 and MIR:MI0000820). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
1: 20752993-20753111 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from mmu-mir-133b
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-133b-5p

Accession MIMAT0017083
Description Mus musculus mmu-miR-133b-5p mature miRNA
Sequence 29 - GCUGGUCAAACGGAACCAAGUC - 50
Evidence experimental
Illumina [5]
Database links
Predicted targets

Mature mmu-miR-133b-3p

Accession MIMAT0000769
Description Mus musculus mmu-miR-133b-3p mature miRNA
Sequence 66 - UUUGGUCCCCUUCAACCAGCUA - 87
Evidence experimental
cloned [2-3], Illumina [4-5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540

  3. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  4. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  5. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267