Accession | MIMAT0001541 |
Description | hsa-miR-449a mature miRNA |
Hairpins | |
Sequence | UGGCAGUGUAUUGUUAGCUGGU |
Evidence |
experimental
cloned [1-2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:0051898 negative regulation of phosphatidylinositol 3-kinase/protein kinase B signal transduction |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25487955 | |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24429361 | has_input UniProtKB:P08887 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25487955 | has_input UniProtKB:P56270 |
involved_in | GO:0008285 negative regulation of cell population proliferation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25487955 | |
involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25487955 | has_input UniProtKB:P98170 |
involved_in | GO:0030336 negative regulation of cell migration |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25487955 | |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24429361 | has_input UniProtKB:P08887 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25487955 | has_input UniProtKB:P56270 |
involved_in | GO:2001235 positive regulation of apoptotic signaling pathway |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25487955 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|