Accession | MIMAT0002817 |
Description | hsa-miR-495-3p mature miRNA |
Hairpins | |
Sequence | AAACAAACAUGGUGCACUUCUU |
Evidence |
experimental
array-cloned [1], cloned [2], SOLiD [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:1905700 negative regulation of xenobiotic detoxification by transmembrane export across the plasma membrane |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:28411377 | |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28411377 | has_input UniProtKB:P08183 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25466836 | has_input UniProtKB:P13500 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27538588 | has_input UniProtKB:Q14119 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28411377 | has_input UniProtKB:P08183 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:33179110 | has_input UniProtKB:P40763 |
involved_in | GO:0032410 negative regulation of transporter activity |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:28411377 | has_input UniProtKB:P08183 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25466836 | has_input UniProtKB:P13500 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27538588 | has_input UniProtKB:Q14119 |
involved_in | GO:0035278 miRNA-mediated gene silencing by inhibition of translation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28411377 | has_input UniProtKB:P08183 |
involved_in | GO:0035279 miRNA-mediated gene silencing by mRNA destabilization |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:33179110 | has_input UniProtKB:P40763 |
involved_in | GO:0045602 negative regulation of endothelial cell differentiation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:27538588 | occurs_in CL:0002619 |
involved_in | GO:0090051 negative regulation of cell migration involved in sprouting angiogenesis |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:27538588 | |
involved_in | GO:1900087 positive regulation of G1/S transition of mitotic cell cycle |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25466836 | occurs_in CL:0002618 |
involved_in | GO:1903588 negative regulation of blood vessel endothelial cell proliferation involved in sprouting angiogenesis |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:27538588 | |
involved_in | GO:1903671 negative regulation of sprouting angiogenesis |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:25085941 | |
involved_in | GO:1905563 negative regulation of vascular endothelial cell proliferation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:25085941 | occurs_in UBERON:0001917 |
involved_in | GO:1905564 positive regulation of vascular endothelial cell proliferation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25466836 | results_in_division_of CL:0002618 |
involved_in | GO:1905652 negative regulation of artery morphogenesis |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:25085941 | |
involved_in | GO:2000352 negative regulation of endothelial cell apoptotic process |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25466836 | occurs_in CL:0002618 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|