Accession | MIMAT0002824 |
Description | hsa-miR-498-5p mature miRNA |
Hairpins | |
Sequence | UUUCAAGCCAGGGGGCGUUUUUC |
Evidence |
experimental
array-cloned [1], cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:0030512 negative regulation of transforming growth factor beta receptor signaling pathway |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30592286 | |
acts_upstream_of | GO:0043433 negative regulation of DNA-binding transcription factor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30592286 | has_input UniProtKB:O60315 |
acts_upstream_of | GO:0090090 negative regulation of canonical Wnt signaling pathway |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30592286 | |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30592286 | has_input UniProtKB:O60315 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30592286 | has_input UniProtKB:O60315 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30592286 | has_input UniProtKB:O60315 |
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|