Accession | MIMAT0002891 |
Description | hsa-miR-18a-3p mature miRNA |
Hairpins | |
Sequence | ACUGCCCUAAGUGCUCCUUCUGG |
Evidence |
experimental
cloned [4-6] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|