miRBase entry: hsa-mir-18a

Stem-loop hsa-mir-18a


Accession
MI0000072
Symbol
HGNC: MIR18A
Description
Homo sapiens hsa-mir-18a precursor miRNA mir-17
Gene
family?
RF00051; mir-17

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR18A is an oncogenic microRNA whose expression is influenced by the biomechanical properties of the cellular environment in glioma cells [PMC5876527]. Specifically, studies have demonstrated that an increase in matrix stiffness, as well as a higher concentration of fibronectin, correlates with elevated levels of MIR18A expression [PMC5876527]. However, the provided context does not offer information regarding the expression levels of MIR18A within the miR-17-92 cluster or its comparison to miR17, miR19a, and miR20a, and thus no conclusions can be drawn about its relative expression within this cluster [PMC9322280].

Literature search
274 open access papers mention hsa-mir-18a
(833 sentences)

Sequence

630349 reads, 8032 reads per million, 124 experiments
uguucUAAGGUGCAUCUAGUGCAGAUAGugaaguagauuagcaucuACUGCCCUAAGUGCUCCUUCUGGca
((((..((((.((((.(((.((((.(((((..(.....)..)).))))))).))).)))).))))..))))

Structure
    cU    U    C   U    A   -  aa u 
uguu  AAGG GCAU UAG GCAG UAG ug  g a
||||  |||| |||| ||| |||| ||| ||  | g
acGG  UUCC CGUG AUC CGUC Auc ac  u a
    UC    U    A   C    -   u  ga u 


Annotation confidence High
Do you think this miRNA is real?
Comments
This sequence maps to chromosome 13 and is named miR-18 precursor-13 in reference [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5].

Genome context
chr13: 91350751-91350821 [+]
Clustered miRNAs
5 other miRNAs are < 10 kb from hsa-mir-18a
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-18a is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-18a is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-18a is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-18a-5p

Accession MIMAT0000072
Description Homo sapiens hsa-miR-18a-5p mature miRNA
Sequence 6 - UAAGGUGCAUCUAGUGCAGAUAG - 28
Evidence experimental
cloned [1,3-6], Northern [1]
Database links
Predicted targets

Mature hsa-miR-18a-3p

Accession MIMAT0002891
Description Homo sapiens hsa-miR-18a-3p mature miRNA
Sequence 47 - ACUGCCCUAAGUGCUCCUUCUGG - 69
Evidence experimental
cloned [4-6]
Database links
Predicted targets

References

  1. PubMed ID: 11679670
    Identification of novel genes coding for small expressed RNAs
    "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
    "Science (2001) 294:853-858

  2. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  3. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  4. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  5. PubMed ID: 11914277
    miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs
    "Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G"
    "Genes Dev (2002) 16:720-728

  6. PubMed ID: 15978578
    Identification of human fetal liver miRNAs by a novel method
    "Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X"
    "FEBS Lett (2005) 579:3849-3854