Accession | MIMAT0003301 |
Description | hsa-miR-33b-5p mature miRNA |
Hairpins | |
Sequence | GUGCAUUGCUGUUGCAUUGC |
Evidence |
experimental
SAGE [1], cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:20466882 | has_input UniProtKB:O95477 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:20466882 | has_input UniProtKB:O95477 |
involved_in | GO:0010628 positive regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:24931346 | has_input UniProtKB:Q15788 |
involved_in | GO:0010983 positive regulation of high-density lipoprotein particle clearance |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:24931346 | occurs_in UBERON:0001969 |
involved_in | GO:0032410 negative regulation of transporter activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:20466882 | has_input UniProtKB:O95477 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:20466882 | has_input UniProtKB:O95477 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:24931346 | has_input UniProtKB:P36956 |
involved_in | GO:0042632 cholesterol homeostasis |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:24931346 | occurs_in CL:0000581 |
involved_in | GO:0090370 negative regulation of cholesterol efflux |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:24931346 | occurs_in CL:0000581 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|