| Accession | MIMAT0004499 |
| Description | hsa-miR-26a-1-3p mature miRNA |
| Hairpins | |
| Sequence | CCUAUUCUUGGUUACUUGCACG |
| Evidence |
experimental
cloned [6] |
| Database links |
|
| Predicted targets |
|
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
| Disease | Differential expression | Experiment | Year | Study |
|---|