WARNING: This summary was generated by AI. MIR26A1, a microRNA, has been studied for its role in various clinical conditions and cellular processes. While the SNP rs7372209 in MIR26A1 was not significantly associated with clinical symptoms of infertility or pain severity after Bonferroni correction, it was linked to a non-significant increased risk of endometriosis [PMC5363543]. MIR26A1 has been shown to negatively regulate EZH2 expression, a factor implicated in the survival of aggressive chronic lymphocytic leukemia (CLL) cells [PMC6773411]. The expression of MIR26A1 is inversely correlated with EZH2 levels in CLL, and its upregulation induces apoptosis in CLL cells [PMC6773411]. Furthermore, MIR26A1 is part of a regulatory loop involving EZH2 and TET1 gene expression; it is hypermethylated and silenced in CLL patients, leading to increased levels of EZH2 [PMC5652802]. Treatment with decitabine (DAC) increases MIR26A1 expression while decreasing EZH2 protein levels [PMC5652802]. The regulatory relationship between MIR26A1 and TET1/EZH2 suggests that MIR26A1 may control TET1 at the transcriptional level by modulating EZH2 occupancy at the TET1 promoter [PMC5652802]. This novel regulatory loop between MIR26A1-EZH2 and TET1 provides an explanation for the consistent upregulation of TET1 and EZH2 while MIR26A is hypermethylated in CLL patients [PMC5652802].
g U C gugcag gug ccucgU CAAGUAAUC AGGAUAGGCU g ||| |||||| ||||||||| |||||||||| u cgc gggGCA GUUCAUUGG UCUUAUCCgg c a C U guaacc
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000082 |
| Description | Homo sapiens hsa-miR-26a-5p mature miRNA |
| Sequence | 10 - UUCAAGUAAUCCAGGAUAGGCU - 31 |
| Evidence |
experimental
cloned [2,4-7], Northern [3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004499 |
| Description | Homo sapiens hsa-miR-26a-1-3p mature miRNA |
| Sequence | 49 - CCUAUUCUUGGUUACUUGCACG - 70 |
| Evidence |
experimental
cloned [6] |
| Database links |
|
| Predicted targets |
|
|