Mature hsa-miR-92a-1-5p
| Accession | MIMAT0004507 |
| Description | hsa-miR-92a-1-5p mature miRNA |
| Hairpins | |
| Sequence | AGGUUGGGAUCGGUUGCAAUGCU |
| Evidence |
experimental
cloned [7-8] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26299712 | has_input UniProtKB:Q9Y5W3 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26299712 | has_input UniProtKB:Q9Y5W3 |
| involved_in | GO:0097533 cellular stress response to acid chemical |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26299712 | |
| located_in | GO:0005737 cytoplasm |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25336585 |
miR2Disease
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
| Disease | Differential expression | Experiment | Year | Study |
|---|
