| Accession | MIMAT0004518 | 
| Description | hsa-miR-16-2-3p mature miRNA | 
| Hairpins | |
| Sequence | CCAAUAUUACUGUGCUGCUUUA | 
| Evidence | experimental cloned [7] | 
| Database links |       | 
| Predicted targets |       | 
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
| Disease | Differential expression | Experiment | Year | Study | 
|---|