MIR16-2 is a precursor microRNA located on the intronic region of the Structural Maintenance of Chromosomes 4 (SMC4) on chromosome 3, which is involved in the maturation of miR16-5p [PMC9553902]. It is one of the ten microRNAs with the highest absolute amount, indicating its significant presence in cellular processes [PMC8010072]. The expression of MIR16-2 can be influenced by R-2HG/ERα, which has been shown to decrease miR16-5p expression at the transcriptional level, with potential estrogen response elements (EREs) identified on its promoter region [PMC8479483]. In a study observing gene expression over time, MIR16-2 was found to be upregulated with a fold change of 4.54 [PMC8407676]. Additionally, its levels in fibroblasts are notably high during the S phase but decrease as cells progress through G2M and G1 phases [PMC8713755]. In cancer research, an inverse relationship has been observed between MIR16-2 and oncogenes; for instance, lung cancer's overexpression of BCL2 has been linked to underexpression of MIR15A and MIR16 family members including MIR16-1 and MIR16-2 [PMC2683874].
c cU UA C agugaaa guu cacu AGCAGCACG AAUAUUGG Gu u ||| |||| ||||||||| |||||||| || a cag gugA UCGUCGUGU UUAUAACC ca u u UU CA a aauuaua
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000069 |
| Description | Homo sapiens hsa-miR-16-5p mature miRNA |
| Sequence | 10 - UAGCAGCACGUAAAUAUUGGCG - 31 |
| Evidence |
experimental
cloned [1,3-4,6-8], Northern [3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004518 |
| Description | Homo sapiens hsa-miR-16-2-3p mature miRNA |
| Sequence | 53 - CCAAUAUUACUGUGCUGCUUUA - 74 |
| Evidence |
experimental
cloned [7] |
| Database links |
|
| Predicted targets |
|
|