Accession | MIMAT0004555 |
Description | hsa-miR-10a-3p mature miRNA |
Hairpins | |
Sequence | CAAAUUCGUAUCUAGGGGAAUA |
Evidence |
experimental
cloned [2] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
involved_in | GO:0016525 negative regulation of angiogenesis |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | |
involved_in | GO:0043537 negative regulation of blood vessel endothelial cell migration |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | |
involved_in | GO:0110059 negative regulation of blood vessel endothelial cell differentiation |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | |
involved_in | GO:1903769 negative regulation of cell proliferation in bone marrow |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | |
involved_in | GO:2000774 positive regulation of cellular senescence |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | occurs_in CL:0002092 |