miRBase entry: hsa-mir-10a

Stem-loop hsa-mir-10a


Accession
MI0000266
Symbol
HGNC: MIR10A
Description
Homo sapiens hsa-mir-10a precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR10A is a microRNA implicated in the regulation of gene expression and has been observed to influence the metastatic potential of cervical cancer cells by targeting the tumor suppressor gene PTEN [PMC6398879]. Additionally, MIR10A has been reported to interact with the 5' untranslated regions (UTRs) of mRNAs, particularly those with a terminal oligopyrimidine (TOP) motif, which can lead to both repression and activation of translation, suggesting a complex role in post-transcriptional regulation [PMC1794424]. Research findings have also indicated an upregulation of MIR10A in certain contexts, while other microRNAs did not exhibit significant changes in expression levels [PMC6132736].

Literature search
272 open access papers mention hsa-mir-10a
(1858 sentences)

Sequence

1320566 reads, 2688 reads per million, 130 experiments
gaucugucugucuucuguauaUACCCUGUAGAUCCGAAUUUGUGuaaggaauuuuguggucaCAAAUUCGUAUCUAGGGGAAUAuguaguugacauaaacacuccgcucu
....(((.((((..((((((((.((((.(((((.((((((((((................)))))))))).))))))))).))))))))..))))...))).........

Structure
-----gauc   --c    uu        A    G     C          uaaggaa 
         ugu   uguc  cuguauaU CCCU UAGAU CGAAUUUGUG       u
         |||   ||||  |||||||| |||| ||||| ||||||||||        
         aca   acag  gauguAUA GGGG AUCUA GCUUAAACac       u
ucucgccuc   aau    uu        A    -     U          ugguguu 


Annotation confidence High
Do you think this miRNA is real?
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Mature products were later verified in human [2].

Genome context
chr17: 48579838-48579947 [-]

Disease association
hsa-mir-10a is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-10a-5p

Accession MIMAT0000253
Description Homo sapiens hsa-miR-10a-5p mature miRNA
Sequence 22 - UACCCUGUAGAUCCGAAUUUGUG - 44
Evidence experimental
cloned [2-3]
Database links
Predicted targets

Mature hsa-miR-10a-3p

Accession MIMAT0004555
Description Homo sapiens hsa-miR-10a-3p mature miRNA
Sequence 63 - CAAAUUCGUAUCUAGGGGAAUA - 84
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540