WARNING: This summary was generated by AI. MIR10A is a microRNA implicated in the regulation of gene expression and has been observed to influence the metastatic potential of cervical cancer cells by targeting the tumor suppressor gene PTEN [PMC6398879]. Additionally, MIR10A has been reported to interact with the 5' untranslated regions (UTRs) of mRNAs, particularly those with a terminal oligopyrimidine (TOP) motif, which can lead to both repression and activation of translation, suggesting a complex role in post-transcriptional regulation [PMC1794424]. Research findings have also indicated an upregulation of MIR10A in certain contexts, while other microRNAs did not exhibit significant changes in expression levels [PMC6132736].
-----gauc --c uu A G C uaaggaa
ugu uguc cuguauaU CCCU UAGAU CGAAUUUGUG u
||| |||| |||||||| |||| ||||| ||||||||||
aca acag gauguAUA GGGG AUCUA GCUUAAACac u
ucucgccuc aau uu A - U ugguguu
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000253 |
| Description | Homo sapiens hsa-miR-10a-5p mature miRNA |
| Sequence | 22 - UACCCUGUAGAUCCGAAUUUGUG - 44 |
| Evidence |
experimental
cloned [2-3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004555 |
| Description | Homo sapiens hsa-miR-10a-3p mature miRNA |
| Sequence | 63 - CAAAUUCGUAUCUAGGGGAAUA - 84 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
|