Accession | MIMAT0004568 |
Description | hsa-miR-221-5p mature miRNA |
Hairpins | |
Sequence | ACCUGGCAUACAAUGUAGAUUU |
Evidence |
experimental
cloned [3] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23770133 | has_input UniProtKB:Q9UBB5 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23770133 | has_input UniProtKB:Q9UBB5 |
located_in | GO:0005615 extracellular space |
ECO:0007005 high throughput direct assay evidence used in manual assertion |
PMID:26646931 | part_of UBERON:0001969 |