miRBase entry: hsa-mir-221

Stem-loop hsa-mir-221


Accession
MI0000298
Symbol
HGNC: MIR221
Description
Homo sapiens hsa-mir-221 precursor miRNA mir-221
Gene
family?
RF00651; mir-221

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR221, a microRNA, has been implicated in various cellular processes, including apoptosis and autophagy, as well as in the pathogenesis of multiple hyperlipidemia-related diseases (HRDs) and cancer [PMC7318537; PMC8436230;'>PMC8436230; PMC7604447; PMC4389881].'>PMC4389881].. Inhibition of MIR221 has been shown to increase apoptosis in transfected cells [PMC7318537]. Moreover, MIR221 appears to be involved in the regulation of autophagic flux, as evidenced by the aggregation of P62 in cells transfected with MIR221 mimics [PMC8436230]. In the context of atherosclerosis and vascular calcification, MIR221 is one among several miRNAs whose expression levels are altered [PMC6683928]. Additionally, MIR221 has been identified as an oncomiR that can promote cancer cell growth by targeting PTEN expression and activating oncogenic pathways such as PI3K/Akt/mTOR [PMC4389881; PMC8071157].. The expression level of MIR221 can be normalized to U6 RNA for analytical purposes [PMC8327461], and its levels along with other clinical features can be used to predict patient outcomes in diseases such as hyperlipidemia-related liver cancer associated with cholangiocarcinoma (HL-CCA) using statistical models like SPSS software [PMC7075433].

Literature search
572 open access papers mention hsa-mir-221
(4115 sentences)

Sequence

1352660 reads, 5088 reads per million, 157 experiments
ugaacauccaggucuggggcaugaACCUGGCAUACAAUGUAGAUUUcuguguucguuaggcaacAGCUACAUUGUCUGCUGGGUUUCaggcuaccuggaaacauguucuc
.((((((((((((....(((.(((((((((((.(((((((((....(((((((.....))).))))))))))))).))))))).)))).))))))))))....)))))..

Structure
-u     ----       cugg   a    -       U         AUUU    -   c 
  gaaca    uccaggu    ggc ugaA CCUGGCA ACAAUGUAG    cugu guu g
  |||||    |||||||    ||| |||| ||||||| |||||||||    |||| ||| u
  cuugu    aggucca    ucg aCUU GGGUCGU UGUUACAUC    GAca cgg u
cu     acaa       ----   g    U       C         ----    a   a 


Annotation confidence High
Do you think this miRNA is real?
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and later validated in human HL-60 leukemia cells [2].

Genome context
chrX: 45746157-45746266 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-221
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-221 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-221-5p

Accession MIMAT0004568
Description Homo sapiens hsa-miR-221-5p mature miRNA
Sequence 25 - ACCUGGCAUACAAUGUAGAUUU - 46
Evidence experimental
cloned [3]
Database links
Predicted targets

Mature hsa-miR-221-3p

Accession MIMAT0000278
Description Homo sapiens hsa-miR-221-3p mature miRNA
Sequence 65 - AGCUACAUUGUCUGCUGGGUUUC - 87
Evidence experimental
cloned [2-4], Illumina [5]
Database links
Predicted targets

References

  1. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  4. PubMed ID: 20158877
    Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
    Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
    BMC Genomics (2010) 11:S6

  5. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540