Mature hsa-miR-27b-5p
| Accession | MIMAT0004588 |
| Description | hsa-miR-27b-5p mature miRNA |
| Hairpins | |
| Sequence | AGAGCUUAGCUGAUUGGUGAAC |
| Evidence |
experimental
cloned [4-5] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| acts_upstream_of_or_within | GO:0010804 negative regulation of tumor necrosis factor-mediated signaling pathway |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:31124343 | occurs_in CL:0000214 |
| acts_upstream_of_or_within | GO:1901223 negative regulation of non-canonical NF-kappaB signal transduction |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:31124343 | occurs_in CL:0000214 |
| acts_upstream_of_or_within | GO:2001244 positive regulation of intrinsic apoptotic signaling pathway |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:31124343 | occurs_in CL:0000214 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31124343 | occurs_in CL:0000214 |
| involved_in | GO:0032691 negative regulation of interleukin-1 beta production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31124343 | occurs_in CL:0000214 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31124343 | occurs_in CL:0000214 |
