Accession | MIMAT0004594 |
Description | hsa-miR-132-5p mature miRNA |
Hairpins | |
Sequence | ACCGUGGCUUUCGAUUGUUACU |
Evidence |
experimental
cloned [2] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24924687 | has_input UniProtKB:Q96EB6 |
involved_in | GO:0010575 positive regulation of vascular endothelial growth factor production |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | |
involved_in | GO:0010628 positive regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24924687 | has_input UniProtKB:P14780 |
involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24924687 | has_input UniProtKB:P36956 |
involved_in | GO:0031393 negative regulation of prostaglandin biosynthetic process |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | |
involved_in | GO:0032691 negative regulation of interleukin-1 beta production |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | |
involved_in | GO:0032715 negative regulation of interleukin-6 production |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | |
involved_in | GO:0032717 negative regulation of interleukin-8 production |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | |
involved_in | GO:0032720 negative regulation of tumor necrosis factor production |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24924687 | has_input UniProtKB:Q96EB6 |
involved_in | GO:0042632 cholesterol homeostasis |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24924687 | occurs_in CL:0002618 |
involved_in | GO:0043537 negative regulation of blood vessel endothelial cell migration |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24924687 | results_in_movement_of CL:0002618 |
involved_in | GO:0051771 negative regulation of nitric-oxide synthase biosynthetic process |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | |
involved_in | GO:0055089 fatty acid homeostasis |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24924687 | occurs_in CL:0002618 |
involved_in | GO:1900408 negative regulation of cellular response to oxidative stress |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | |
involved_in | GO:1901223 negative regulation of non-canonical NF-kappaB signal transduction |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | |
involved_in | GO:1905563 negative regulation of vascular endothelial cell proliferation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24924687 | results_in_division_of CL:0002618 |
involved_in | GO:2000353 positive regulation of endothelial cell apoptotic process |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24924687 | occurs_in CL:0002618 |
involved_in | GO:2001243 negative regulation of intrinsic apoptotic signaling pathway |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|