MIR132 is a microRNA that is involved in various biological processes. It has been found to be present in high levels in small extracellular vesicles derived from cancer stem cells, along with miR-210 and miR-146a-3p, which enhance anti-apoptotic and pro-angiogenic activity [PMC6281951]. However, no significant differences were observed in the levels of MIR132 between two studied genotypes, suggesting that it does not induce degradation of Mmp9 mRNA [PMC9389266]. MIR132 is induced by neuronal activities and its knockdown in the hippocampus has been shown to impair fear memory acquisition in mice [PMC5764268] [PMC9389266]. Additionally, MIR132 overexpression has been found to affect postsynaptic sensitivity to neurotransmitters and the number of functional synapses [PMC3012071]. In a study on S. pneumoniae meningitis, significant down-regulation of both miR146a and MIR132 was observed, suggesting their potential role in understanding the pathogenesis of the disease at a posttranscriptional level [PMC4439992]. In cardiomyocytes of rat models with dilated cardiomyopathy (DCM), MIR132 was found to be reduced [PMC7827163]. Furthermore, it has been shown that overexpression of MIR132 leads to an increase in its mature form and is required for normal dendrite maturation in newborn neurons in the adult hippocampus [PMC2993964] [PMC5764268]. One potential explanation for these findings is that MIR132 targets multiple mRNA species involved in neuronal complexity regulation, such as p250 GAP [PMC2993964].
c cccc - c a a UUC --gu g cgc gcgu cu c gggc ACCGUGGCU GAUUGUUACU g g ||| |||| || | |||| ||||||||| |||||||||| | gcg cgca ga g cccG UGGUACCGA CUGACAAUgg c a c cacc c c c C CAU aggu a
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004594 |
Description | Homo sapiens hsa-miR-132-5p mature miRNA |
Sequence | 23 - ACCGUGGCUUUCGAUUGUUACU - 44 |
Evidence |
experimental
cloned [2] |
Database links | |
Predicted targets |
Accession | MIMAT0000426 |
Description | Homo sapiens hsa-miR-132-3p mature miRNA |
Sequence | 59 - UAACAGUCUACAGCCAUGGUCG - 80 |
Evidence |
experimental
cloned [2-3] |
Database links | |
Predicted targets |
|