miRBase entry: hsa-mir-132

Stem-loop hsa-mir-132


Accession
MI0000449
Symbol
HGNC: MIR132
Description
Homo sapiens hsa-mir-132 precursor miRNA mir-132
Gene
family?
RF00662; mir-132

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR132 is a microRNA that is involved in various biological processes. It has been found to be present in high levels in small extracellular vesicles derived from cancer stem cells, along with miR-210 and miR-146a-3p, which enhance anti-apoptotic and pro-angiogenic activity [PMC6281951]. However, no significant differences were observed in the levels of MIR132 between two studied genotypes, suggesting that it does not induce degradation of Mmp9 mRNA [PMC9389266]. MIR132 is induced by neuronal activities and its knockdown in the hippocampus has been shown to impair fear memory acquisition in mice [PMC5764268] [PMC9389266]. Additionally, MIR132 overexpression has been found to affect postsynaptic sensitivity to neurotransmitters and the number of functional synapses [PMC3012071]. In a study on S. pneumoniae meningitis, significant down-regulation of both miR146a and MIR132 was observed, suggesting their potential role in understanding the pathogenesis of the disease at a posttranscriptional level [PMC4439992]. In cardiomyocytes of rat models with dilated cardiomyopathy (DCM), MIR132 was found to be reduced [PMC7827163]. Furthermore, it has been shown that overexpression of MIR132 leads to an increase in its mature form and is required for normal dendrite maturation in newborn neurons in the adult hippocampus [PMC2993964] [PMC5764268]. One potential explanation for these findings is that MIR132 targets multiple mRNA species involved in neuronal complexity regulation, such as p250 GAP [PMC2993964].

Literature search
285 open access papers mention hsa-mir-132
(1581 sentences)

Sequence

54874 reads, 1698 reads per million, 128 experiments
ccgcccccgcgucuccagggcaACCGUGGCUUUCGAUUGUUACUgugggaacuggaggUAACAGUCUACAGCCAUGGUCGccccgcagcacgcccacgcgc
.(((....((((((.(.((((.(((((((((...((((((((((..(....)....))))))))))...))))))))).)))).).)).))))....))).

Structure
c   cccc    -  c a    a         UUC          --gu g 
 cgc    gcgu cu c gggc ACCGUGGCU   GAUUGUUACU    g g
 |||    |||| || | |||| |||||||||   ||||||||||    |  
 gcg    cgca ga g cccG UGGUACCGA   CUGACAAUgg    c a
c   cacc    c  c c    C         CAU          aggu a 


Annotation confidence High
Do you think this miRNA is real?
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context
chr17: 2049908-2050008 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-132
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-132 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-132 is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-132 is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-132-5p

Accession MIMAT0004594
Description Homo sapiens hsa-miR-132-5p mature miRNA
Sequence 23 - ACCGUGGCUUUCGAUUGUUACU - 44
Evidence experimental
cloned [2]
Database links
Predicted targets

Mature hsa-miR-132-3p

Accession MIMAT0000426
Description Homo sapiens hsa-miR-132-3p mature miRNA
Sequence 59 - UAACAGUCUACAGCCAUGGUCG - 80
Evidence experimental
cloned [2-3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739