Accession | MIMAT0004603 |
Description | hsa-miR-125b-2-3p mature miRNA |
Hairpins | |
Sequence | UCACAAGUCAGGCUCUUGGGAC |
Evidence |
experimental
cloned [5] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|