MIR125B2 is a gene that was identified through the analysis of SNP sites in the genomic DNAs of offspring [PMC10014956]. This gene, along with other genes such as COL11A1, COL12A1, CATSPER2, KCNJ12, GP6 (ENSG00000088053), MIR99A (ENSG00000207638), MIR99AHG (ENSG00000215386), MIRLET7C (ENSG00000199030), and LINC01250, was selected based on its potential pathogenicity for ACL rupture and its shared regions in affected family members [PMC9536556]. These genes were also chosen because they have been previously associated with ACL rupture and have shared biology/function [PMC9536556]. The identification of SNP sites in the offspring's genomic DNAs allowed for the determination of the imprinting status of MIR125B2 [PMC10014956]. The selection of these specific genes was based on their potential role in ACL rupture and their shared characteristics with previously identified associated genes [PMC9536556]. This approach allowed for a comprehensive analysis that considered both genetic factors and shared biology/function in order to identify potential pathogenic genes related to ACL rupture.
a aga u - U C A g auu cc cuuu ccuag UCCC GAGA CCU ACUUGUGA gu u || |||| ||||| |||| |||| ||| |||||||| || u gg gagg ggauc AGGG UUCU GGA UGAACACU ca a a --g c C - C C a aug
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000423 |
Description | Homo sapiens hsa-miR-125b-5p mature miRNA |
Sequence | 17 - UCCCUGAGACCCUAACUUGUGA - 38 |
Evidence |
experimental
cloned [2,4-6], Illumina [7] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004603 |
Description | Homo sapiens hsa-miR-125b-2-3p mature miRNA |
Sequence | 54 - UCACAAGUCAGGCUCUUGGGAC - 75 |
Evidence |
experimental
cloned [5] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|