Mature hsa-miR-185-3p
| Accession | MIMAT0004611 |
| Description | hsa-miR-185-3p mature miRNA |
| Hairpins | |
| Sequence | AGGGGCUGGCUUUCCUCUGGUC |
| Evidence |
experimental
cloned [3] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| acts_upstream_of | GO:0010989 negative regulation of low-density lipoprotein particle clearance |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:24296663 | occurs_in CL:0000182 |
| acts_upstream_of | GO:0045541 negative regulation of cholesterol biosynthetic process |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:24296663 | occurs_in CL:0000182 |
| acts_upstream_of | GO:1905601 negative regulation of receptor-mediated endocytosis involved in cholesterol transport |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:24296663 | occurs_in CL:0000182 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:24296663 | has_input UniProtKB:Q12772 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28277742 | has_input UniProtKB:Q15077 |
| involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:24296663 | has_input UniProtKB:P01130 |
| involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:24296663 | has_input UniProtKB:P37268 |
| involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:24296663 | has_input UniProtKB:P04035 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:24296663 | has_input UniProtKB:Q12772 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28277742 | has_input UniProtKB:Q15077 |
| involved_in | GO:0070373 negative regulation of ERK1 and ERK2 cascade |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28277742 | occurs_in CL:0002539 |
| involved_in | GO:0071397 cellular response to cholesterol |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:24296663 | occurs_in CL:0000182 |
| involved_in | GO:0106108 negative regulation of (R)-mevalonic acid biosynthetic process |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:24296663 | occurs_in CL:0000182 |
| involved_in | GO:1904706 negative regulation of vascular associated smooth muscle cell proliferation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28277742 | results_in_division_of CL:0002539 |
| located_in | GO:0005615 extracellular space |
ECO:0007005 high throughput direct assay evidence used in manual assertion |
PMID:26646931 | part_of UBERON:0001969 |
