Accession | MIMAT0004673 |
Description | hsa-miR-29c-5p mature miRNA |
Hairpins | |
Sequence | UGACCGAUUUCUCCUGGUGUUC |
Evidence |
experimental
cloned [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26045889 | has_input UniProtKB:P05019 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26175848 | has_input UniProtKB:P05019 |
involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26175848 | has_input UniProtKB:P15692 |
involved_in | GO:0016525 negative regulation of angiogenesis |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26175848 | occurs_in CL:0002618 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26045889 | has_input UniProtKB:P05019 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26175848 | has_input UniProtKB:P05019 |
involved_in | GO:0043569 negative regulation of insulin-like growth factor receptor signaling pathway |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26045889 | occurs_in CL:0002618 |
involved_in | GO:0043569 negative regulation of insulin-like growth factor receptor signaling pathway |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26175848 | occurs_in CL:0002618 |
involved_in | GO:0090051 negative regulation of cell migration involved in sprouting angiogenesis |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26045889 | results_in_movement_of CL:0002618 |
involved_in | GO:0090051 negative regulation of cell migration involved in sprouting angiogenesis |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26175848 | |
involved_in | GO:1902807 negative regulation of cell cycle G1/S phase transition |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26045889 | occurs_in CL:0002618 |
involved_in | GO:1903588 negative regulation of blood vessel endothelial cell proliferation involved in sprouting angiogenesis |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26045889 | results_in_division_of CL:0002618 |
involved_in | GO:1905563 negative regulation of vascular endothelial cell proliferation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26175848 |