Accession | MIMAT0004761 |
Description | hsa-miR-483-5p mature miRNA |
Hairpins | |
Sequence | AAGACGGGAGGAAAGAAGGGAG |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:0001933 negative regulation of protein phosphorylation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:33915734 | has_input UniProtKB:P10636 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:33915734 | |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21893058 | has_input UniProtKB:P11831 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:33915734 | has_input UniProtKB:P27361 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:33915734 | has_input UniProtKB:P27361 |
involved_in | GO:0035278 miRNA-mediated gene silencing by inhibition of translation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21893058 | has_input UniProtKB:P11831 |
involved_in | GO:0090051 negative regulation of cell migration involved in sprouting angiogenesis |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:21893058 | occurs_in CL:0000071 |
involved_in | GO:1903588 negative regulation of blood vessel endothelial cell proliferation involved in sprouting angiogenesis |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:21893058 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|