Accession | MIMAT0004763 |
Description | hsa-miR-488-3p mature miRNA |
Hairpins | |
Sequence | UUGAAAGGCUAUUUCUUGGUC |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28915828 | has_input UniProtKB:P01584 |
involved_in | GO:0032691 negative regulation of interleukin-1 beta production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28915828 | occurs_in CL:0000235 |
involved_in | GO:0032717 negative regulation of interleukin-8 production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28915828 | occurs_in CL:0000235 |
involved_in | GO:0032720 negative regulation of tumor necrosis factor production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28915828 | occurs_in CL:0000235 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28915828 | has_input UniProtKB:P01584 |
involved_in | GO:0050728 negative regulation of inflammatory response |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28915828 | occurs_in CL:0000235 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|