Accession | MIMAT0004928 |
Description | hsa-miR-147b-3p mature miRNA |
Hairpins | |
Sequence | GUGUGCGGAAAUGCUUCUGCU |
Evidence |
experimental
cloned [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
involved_in | GO:0010628 positive regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29384235 | occurs_in CL:0000047 |
involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29384235 | occurs_in CL:0000047 |
involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:29384235 | occurs_in CL:0000127 |
involved_in | GO:0031393 negative regulation of prostaglandin biosynthetic process |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:29384235 | occurs_in CL:0000127 |
involved_in | GO:0032715 negative regulation of interleukin-6 production |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:29384235 | occurs_in CL:0000127 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:29384235 | occurs_in CL:0000127 |
involved_in | GO:0045666 positive regulation of neuron differentiation |
ECO:0000305 curator inference used in manual assertion |
PMID:29384235 | |
involved_in | GO:0045746 negative regulation of Notch signaling pathway |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29384235 | occurs_in CL:0000047 |
involved_in | GO:0045916 negative regulation of complement activation |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:29384235 | occurs_in CL:0000127 |
involved_in | GO:0050728 negative regulation of inflammatory response |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:29384235 | occurs_in CL:0000127 |
involved_in | GO:0060253 negative regulation of glial cell proliferation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29384235 | occurs_in CL:0000127 |
involved_in | GO:1903996 negative regulation of non-membrane spanning protein tyrosine kinase activity |
ECO:0000305 curator inference used in manual assertion |
PMID:29384235 | occurs_in CL:0000047 |
involved_in | GO:2000736 regulation of stem cell differentiation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29384235 | occurs_in CL:0000047 |