Mature dme-miR-996-3p
| Accession | MIMAT0005515 |
| Description | dme-miR-996-3p mature miRNA |
| Hairpins | |
| Sequence | UGACUAGAUUUCAUGCUCGUCU |
| Evidence |
experimental
454 [1-2], Illumina [2] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26042831 | |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27802174 | |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29196461 | |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29540498 | |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26042831 | |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27802174 | |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29196461 | |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29540498 | |
| involved_in | GO:0042059 negative regulation of epidermal growth factor receptor signaling pathway |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:29540498 | |
| involved_in | GO:0045665 negative regulation of neuron differentiation |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:26042831 | |
| involved_in | GO:0045747 positive regulation of Notch signaling pathway |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:29196461 | |
| involved_in | GO:0045747 positive regulation of Notch signaling pathway |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:29196461 | |
| involved_in | GO:1904059 regulation of locomotor rhythm |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:26042831 |
