Accession | MIMAT0005796 |
Description | hsa-miR-1271-5p mature miRNA |
Hairpins | |
Sequence | CUUGGCACCUAGCAAGCACUCA |
Evidence |
experimental
Illumina [2], 454 [3] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:0045719 negative regulation of glycogen biosynthetic process |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27613089 | occurs_in CL:0000182 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27613089 | has_input UniProtKB:P35568 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27613089 | has_input UniProtKB:P35568 |
involved_in | GO:0035278 miRNA-mediated gene silencing by inhibition of translation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27613089 | has_input UniProtKB:P35568 |
involved_in | GO:0046627 negative regulation of insulin receptor signaling pathway |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27613089 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|