WARNING: This summary was generated by AI. MIR1271 is identified as a tumor suppressor microRNA with a significant role in hepatocellular carcinoma (HCC) [PMC7425487]. It has been observed that there is a negative correlation between FOXK2 mRNA and MIR1271 in HCC patient samples, suggesting that MIR1271 may play a role in modulating FOXK2 expression [PMC6468357]. Additionally, MIR1271 is involved in the regulation of CCNG1, another tumor suppressor, indicating its importance in the tumor suppressive network [PMC5772750]. Beyond its role in HCC, MIR1271 has also been found to directly regulate lactate dehydrogenase A (LDHA) across various tumors, which is crucial for cancer metabolism and progression [PMC9742379]. Bioinformatics analyses have further elucidated the regulatory network of MIR1271 by identifying its gene enhancers using the genehancer database [PMC8454712]. Moreover, there is evidence that circSERPINE2 may act as a competing endogenous RNA for MIR1271 and influence the anabolism of the extracellular matrix during osteoarthritis progression [PMC7393488]. This highlights the diverse regulatory roles of MIR1271 across different biological processes and diseases.
-ca - au C A a cc cag cagugCUUGGCAC UAGCA GCACUCAguaa u || ||| ||||||||||||| ||||| ||||||||||| gg guc guuACGGACCGUG AUCGU CGUGAguuguu a ucg a gu U C u
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0005796 |
| Description | Homo sapiens hsa-miR-1271-5p mature miRNA |
| Sequence | 15 - CUUGGCACCUAGCAAGCACUCA - 36 |
| Evidence |
experimental
Illumina [2], 454 [3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0022712 |
| Description | Homo sapiens hsa-miR-1271-3p mature miRNA |
| Sequence | 51 - AGUGCCUGCUAUGUGCCAGGCA - 72 |
| Evidence | not_experimental |
| Database links |
|
| Predicted targets |
|
|