miRBase entry: hsa-mir-1271

Stem-loop hsa-mir-1271


Accession
MI0003814
Symbol
HGNC: MIR1271
Description
Homo sapiens hsa-mir-1271 precursor miRNA mir-1271
Gene
family?
RF04085; mir-1271

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR1271 is identified as a tumor suppressor microRNA with a significant role in hepatocellular carcinoma (HCC) [PMC7425487]. It has been observed that there is a negative correlation between FOXK2 mRNA and MIR1271 in HCC patient samples, suggesting that MIR1271 may play a role in modulating FOXK2 expression [PMC6468357]. Additionally, MIR1271 is involved in the regulation of CCNG1, another tumor suppressor, indicating its importance in the tumor suppressive network [PMC5772750]. Beyond its role in HCC, MIR1271 has also been found to directly regulate lactate dehydrogenase A (LDHA) across various tumors, which is crucial for cancer metabolism and progression [PMC9742379]. Bioinformatics analyses have further elucidated the regulatory network of MIR1271 by identifying its gene enhancers using the genehancer database [PMC8454712]. Moreover, there is evidence that circSERPINE2 may act as a competing endogenous RNA for MIR1271 and influence the anabolism of the extracellular matrix during osteoarthritis progression [PMC7393488]. This highlights the diverse regulatory roles of MIR1271 across different biological processes and diseases.

Literature search
19 open access papers mention hsa-mir-1271
(34 sentences)

Sequence

15917 reads, 70 reads per million, 121 experiments
cacccagaucagugCUUGGCACCUAGCAAGCACUCAguaaauauuuguugAGUGCCUGCUAUGUGCCAGGCAuugugcugagggcu
..(((((..(((((((((((((.(((((.(((((((((((....))))))))))).))))).)))))))))))))..))).))...

Structure
-ca  -   au             C     A           a 
   cc cag  cagugCUUGGCAC UAGCA GCACUCAguaa u
   || |||  ||||||||||||| ||||| |||||||||||  
   gg guc  guuACGGACCGUG AUCGU CGUGAguuguu a
ucg  a   gu             U     C           u 


Annotation confidence Medium
Do you think this miRNA is real?

Genome context
chr5: 176367946-176368031 [+]

Disease association
hsa-mir-1271 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-1271-5p

Accession MIMAT0005796
Description Homo sapiens hsa-miR-1271-5p mature miRNA
Sequence 15 - CUUGGCACCUAGCAAGCACUCA - 36
Evidence experimental
Illumina [2], 454 [3]
Database links
Predicted targets

Mature hsa-miR-1271-3p

Accession MIMAT0022712
Description Homo sapiens hsa-miR-1271-3p mature miRNA
Sequence 51 - AGUGCCUGCUAUGUGCCAGGCA - 72
Evidence not_experimental
Database links
Predicted targets

References

  1. PubMed ID: 16954537
    Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
    "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
    "Genome Res (2006) 16:1289-1298

  2. PubMed ID: 18285502
    Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells
    "Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA"
    "Genome Res (2008) 18:610-621

  3. PubMed ID: 19508715
    Identification and analysis of miRNAs in human breast cancer and teratoma samples using deep sequencing
    Nygaard S, Jacobsen A, Lindow M, Eriksen J, Balslev E, Flyger H, Tolstrup N, Møller S, Krogh A, Litman T
    BMC Med Genomics (2009) 2:35