Home
(current)
Search
Browse
Help
Downloads
Home
(current)
Search
Browse
Help
Downloads
miRBase entry: hsa-miR-1271-3p
Mature
hsa-miR-1271-3p
Accession
MIMAT0022712
Description
hsa-miR-1271-3p mature miRNA
Hairpins
hsa-mir-1271
Sequence
AGUGCCUGCUAUGUGCCAGGCA
Copy Sequence
Evidence
not_experimental
Database links
Predicted targets