Mature hsa-miR-1262
| Accession | MIMAT0005914 |
| Description | hsa-miR-1262 mature miRNA |
| Hairpins | |
| Sequence | AUGGGUGAAUUUGUAGAAGGAU |
| Evidence |
experimental
Illumina [1] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| acts_upstream_of_or_within | GO:0010629 negative regulation of gene expression |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:25584808 | occurs_in CL:0000057 |
