Mature dme-miR-10-3p
| Accession | MIMAT0012531 |
| Description | dme-miR-10-3p mature miRNA |
| Hairpins | |
| Sequence | CAAAUUCGGUUCUAGAGAGGUUU |
| Evidence |
experimental
cloned [1,3], Northern [1-3], 454 [4-5], Illumina [5] |
| Database links |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:35573695 | |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:35573695 | |
| involved_in | GO:0045879 negative regulation of smoothened signaling pathway |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:35573695 |
