Home
(current)
Search
Browse
Help
Downloads
Home
(current)
Search
Browse
Help
Downloads
miRBase entry: bmo-miR-2758-5p
Mature
bmo-miR-2758-5p
Accession
MIMAT0013629
Description
bmo-miR-2758-5p mature miRNA
Hairpins
bmo-mir-2758
Sequence
ACUUGGUAGAACACGUAGUAAG
Copy Sequence
Evidence
experimental
Illumina [1], SOLID [2]
Database links