Accession | MIMAT0017259 |
Description | mmu-miR-505-5p mature miRNA |
Hairpins | |
Sequence | GGGAGCCAGGAAGUAUUGAUGUU |
Evidence |
experimental
Illumina [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31544253 | occurs_in CL:0002586 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31544253 | occurs_in CL:0002586 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31544253 | occurs_in CL:0002586 |
involved_in | GO:0071380 cellular response to prostaglandin E stimulus |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:31544253 | occurs_in CL:0002476 |