Accession | MIMAT0020791 |
Description | dme-miR-8-5p mature miRNA |
Hairpins | |
Sequence | CAUCUUACCGGGCAGCAUUAGA |
Evidence | not_experimental |
Database links |
![]() |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28691661 | |
involved_in | GO:0035279 miRNA-mediated gene silencing by mRNA destabilization |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28691661 | |
involved_in | GO:0044828 negative regulation by host of viral genome replication |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:28691661 |