Accession | MIMAT0020801 |
Description | dme-miR-275-5p mature miRNA |
Hairpins | |
Sequence | CGCGCUAAUCAGUGACCGGGGCU |
Evidence | not_experimental |
Database links |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:37804878 | |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:37804878 | |
involved_in | GO:0061060 negative regulation of peptidoglycan recognition protein signaling pathway |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:37804878 |