| Accession | MIMAT0020842 |
| Description | dme-miR-316-3p mature miRNA |
| Hairpins | |
| Sequence | ACAGGAAAGGGAAAAAGGCGUA |
| Evidence | not_experimental |
| Database links |
|
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.