Mature hsa-miR-6511a-3p

• Accession: MIMAT0025479
• Description: hsa-miR-6511a-3p mature miRNA
• Hairpins:
  • hsa-mir-6511a-1
  • hsa-mir-6511a-2
  • hsa-mir-6511a-3
  • hsa-mir-6511a-4
• Sequence: CCUCACCAUCCCUUCUGCCUGC
• Evidence: experimental ; Illumina [1-2]

QuickGo Function

QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.

Qualifier	GO term	Evidence	Reference	Annotation Extension
located_in	GO:0005615 extracellular space	ECO:0007005 high throughput direct assay evidence used in manual assertion	PMID:26646931	part_of UBERON:0001969